View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_low_165 (Length: 245)
Name: NF3772_low_165
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_low_165 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 6508317 - 6508091
Alignment:
| Q |
1 |
ctttagtgatcttacccttgattgacgacacatatgatttattgcagagtatggttgcaataagagaagtgacaaagcatatcataaggaaatcagatgg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6508317 |
ctttagtgatcttactcttgattgacgacacatatgatttattgcagagtatggttgcaataagagaagtgacaaagcatatcataaggaaaccagatgg |
6508218 |
T |
|
| Q |
101 |
gagaggggataatggtatagggtatgatcgttttattgttatatccttagggacaggatcaaacaaaagtgagcgcaagtacaatgctaagatggtggct |
200 |
Q |
| |
|
||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6508217 |
gagtggggacaatggtatagggtatgatcgttttattgttatatccttagggacaggatcaaacaaaagtgagcgcaagtacaatgctaagatggtggct |
6508118 |
T |
|
| Q |
201 |
aaatggggtgctttaacttggttattc |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
6508117 |
aaatggggtgctttaacttggttattc |
6508091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 111 - 227
Target Start/End: Complemental strand, 6502724 - 6502608
Alignment:
| Q |
111 |
aatggtatagggtatgatcgttttattgttatatccttagggacaggatcaaacaaaagtgagcgcaagtacaatgctaagatggtggctaaatggggtg |
210 |
Q |
| |
|
|||||||||||||||||||||||||| || || || ||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
6502724 |
aatggtatagggtatgatcgttttatagtgatctcaatagggacaggatcaaacaagagtgagcaaaagtacaatgctaagatggttgctaaatggggtg |
6502625 |
T |
|
| Q |
211 |
ctttaacttggttattc |
227 |
Q |
| |
|
|||| || ||||||||| |
|
|
| T |
6502624 |
ctttgacatggttattc |
6502608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University