View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_low_169 (Length: 243)
Name: NF3772_low_169
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_low_169 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 13 - 227
Target Start/End: Complemental strand, 19399395 - 19399182
Alignment:
| Q |
13 |
aatatcaaagagatccaaaataaacaatattatacttaagcaaacataagaccaatgactatatggacgcaaacgtattaaatataacgaacattcttct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19399395 |
aatatcaaagagatccaaaataaacaatattatacttaagcaaacataagtccaatgactatatggacgcaaacgtattaaacataacgaacattcttct |
19399296 |
T |
 |
| Q |
113 |
ttaactttggcatacttcagtataacaattactggttcatattctttcctctcattatcatgaataaacttcatagcatagtctctcccatagagtacag |
212 |
Q |
| |
|
||||||||||||||||||| |||||||| || ||| |||||||||| |||| |||||| |||||||||||| |||||||||| ||| ||| |||| ||| |
|
|
| T |
19399295 |
ttaactttggcatacttcaacataacaatgaccggtccatattcttttctcttattatcgtgaataaacttcctagcatagtc-ctctcatggagtgcag |
19399197 |
T |
 |
| Q |
213 |
ttaagagtaataaca |
227 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
19399196 |
ttaaaagtaataaca |
19399182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University