View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_low_173 (Length: 242)
Name: NF3772_low_173
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_low_173 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 44837753 - 44837977
Alignment:
| Q |
1 |
tgcttgcatcaaagctatgcactggaccccactttttatatcaaaatctattagatgaattttagtctcaaacttaagatgttcaactatagcttgtatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44837753 |
tgcttgcatcaaagctatgcactggaccccactttttatatcaaaatctattagatgaattttagtctcaaacttaacatgttcaactatagcttgtatt |
44837852 |
T |
|
| Q |
101 |
ccagtaaattgcataacttgattaaaaggaagtttttgatgacacataagtgcnnnnnnngaacccatcttctcaattaactcactttcttcatttttat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44837853 |
ccagtaaattgcataacttgattaaaaggaagtttttgatgacacataagtgctttttttgaacccatcttctcaattaactcactttcttcatttttat |
44837952 |
T |
|
| Q |
201 |
ctgaccctttaaccactcttccagt |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
44837953 |
ctgaccctttaaccactcttccagt |
44837977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 79 - 144
Target Start/End: Original strand, 38927307 - 38927372
Alignment:
| Q |
79 |
atgttcaactatagcttgtattccagtaaattgcataacttgattaaaaggaagtttttgatgaca |
144 |
Q |
| |
|
|||||| ||||||||||||| |||| ||||||||| |||||||| ||||||| |||||||||||| |
|
|
| T |
38927307 |
atgttccactatagcttgtacaccagcaaattgcattacttgattgaaaggaattttttgatgaca |
38927372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University