View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_low_174 (Length: 241)
Name: NF3772_low_174
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_low_174 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 231
Target Start/End: Original strand, 18868054 - 18868267
Alignment:
| Q |
19 |
tcctctgcgcttacagagttgcctttgaaaagggttagcaatgcaggaaaccgcgtgggagattttaatctcagtgaatttgttcacctggattttgaca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18868054 |
tcctctgcgcttacagagttgcctttgaaaagggttagcaatgcaggaaaccgcgtgggagattttaatctcagtgaatttgttcacctggattttgaca |
18868153 |
T |
|
| Q |
119 |
aaggtggttcggccgcatgtaggagatcagaggtttcaaatgtcaagtttcatcttacccaggttcaataccatagtcaaatagatgccaatggtaact- |
217 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
18868154 |
aaggtggttcggctgcctgtaggagatcagaggtttcaaatgtcaagtttcatcttacccaggttcaataccacagtcaaatagatgccaatggtaattg |
18868253 |
T |
|
| Q |
218 |
tttttgctcctttg |
231 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
18868254 |
tttttgctcctttg |
18868267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University