View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_low_179 (Length: 239)
Name: NF3772_low_179
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_low_179 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 11 - 220
Target Start/End: Original strand, 33840549 - 33840759
Alignment:
| Q |
11 |
gagtgagatgaagtgagtgagtagtaaacatcgggatctaagctacttctattaataatgaattactcaattcaaaatgaaatataagtnnnnnnngtta |
110 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33840549 |
gagtgagatggagtgagtgagtagtaaacatcgggatctaagctacttctattaataatgaattactcaattcaaaatgaaatataagtaaaaaaagtta |
33840648 |
T |
 |
| Q |
111 |
ctattctcatttttgtttatatttcattttgaagcataaac-nnnnnnnnatgtgtcttaaacaataatgtcgacacattaacaatctcaaaaatttatt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33840649 |
ctattctcatttttgtttatatttcattttgaagcataaactttttttatgtgtgtcttaaataataatgtcgacacattaacaatctcaaaaatttatt |
33840748 |
T |
 |
| Q |
210 |
tttctctatac |
220 |
Q |
| |
|
||||||||||| |
|
|
| T |
33840749 |
tttctctatac |
33840759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University