View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_low_191 (Length: 237)
Name: NF3772_low_191
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_low_191 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 15378135 - 15378356
Alignment:
| Q |
1 |
aatcaaatcaaattaatgcttattagggtttatctttataaggtattataaaagttgtcacattttgattgatgaaatatcatttcgcttattagagaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |||||| ||||| ||||||||||||| |
|
|
| T |
15378135 |
aatcaaatcaaattaatgcttattagggtgtatctttataaggtgttataaaagttgtcacattttgattgatcaaatatgatttcacttattagagaat |
15378234 |
T |
 |
| Q |
101 |
ttgtagtaacaaactttgtgcattaaatttctttttgcaaaaatgtaaacaaaagaaaatagtacattattaaaattttaaagttttctagttagtcttc |
200 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15378235 |
ttgtagtaacaaactttgtgtactaaatttctttttgcaaaaatgtaaacaaaagaaaatagtacattattaaaattttaaagttttctagttagtcttc |
15378334 |
T |
 |
| Q |
201 |
ttaaaaatctcgatttattaat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
15378335 |
ttaaaaatctcgatttattaat |
15378356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University