View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_low_192 (Length: 237)
Name: NF3772_low_192
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_low_192 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 12 - 221
Target Start/End: Original strand, 45831946 - 45832156
Alignment:
| Q |
12 |
catagggattttgtgactttaaaatgatacaggttagtgatggattagaatagtctttttggagtat-aagaaaccaatgaaagaagcaattgccttaaa |
110 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||| ||||| |||||||||||||||||||| ||||||||||| |||||||||||||| ||||| |
|
|
| T |
45831946 |
catagggattttgtgacttcaaaatgatacaggttggtgagggattggaatagtctttttggagtatgaagaaaccaattaaagaagcaattgctttaaa |
45832045 |
T |
|
| Q |
111 |
gaatctgattgaatttatgcaaaatcacagttatgtgtcttttgacaattctatgacatatctattgatctcatataaacactttcattatttctttttg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
45832046 |
aaatctgattgaatttatgcaaaatcacagttttgtgtcttttgacaattctatgacatatctattgatctcagataaacactttcattaattctttttg |
45832145 |
T |
|
| Q |
211 |
caggttatgtg |
221 |
Q |
| |
|
||||||||||| |
|
|
| T |
45832146 |
caggttatgtg |
45832156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 105 - 181
Target Start/End: Original strand, 32524471 - 32524547
Alignment:
| Q |
105 |
cttaaagaatctgattgaatttatgcaaaatcacagttatgtgtcttttgacaattctatgacatatctattgatct |
181 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
32524471 |
cttaaagaatctgattgaatttatccaaaatcacatttatgtgtcttttgaccattttatgacatatctattgatct |
32524547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 118 - 216
Target Start/End: Complemental strand, 30178423 - 30178325
Alignment:
| Q |
118 |
attgaatttatgcaaaatcacagttatgtgtcttttgacaattctatgacatatctattgatctcatataaacactttcattatttctttttgcaggtt |
216 |
Q |
| |
|
|||||||||||||||||||||| ||| ||| |||||||||||||||| |||||||||| ||| | ||| ||||||||||||| |||||||||||||| |
|
|
| T |
30178423 |
attgaatttatgcaaaatcacacctatatgttttttgacaattctatgtcatatctatttatccaaaatagacactttcattatctctttttgcaggtt |
30178325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 105 - 181
Target Start/End: Complemental strand, 43604157 - 43604081
Alignment:
| Q |
105 |
cttaaagaatctgattgaatttatgcaaaatcacagttatgtgtcttttgacaattctatgacatatctattgatct |
181 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| | | ||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
43604157 |
cttaaagaatctaattgcatttatgcaaaatcaaatctctgtgtcttttgaccattttatgacatatctattgatct |
43604081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University