View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3772_low_196 (Length: 236)

Name: NF3772_low_196
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3772_low_196
NF3772_low_196
[»] chr5 (1 HSPs)
chr5 (9-176)||(35098446-35098613)


Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 9 - 176
Target Start/End: Original strand, 35098446 - 35098613
Alignment:
9 agaagcaaaggatgagagagagggtggaggtatcggatggtgacaggtggagtggagttttgggagataggaagctaaagtctgagatgagagaagctag 108  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35098446 agaaggaaaggatgagagagagggtggaggtatcggatggtgacaggtggagtggagttttgggagataggaagctaaagtctgagatgagagaagctag 35098545  T
109 aaataggtgtcagaattttagtatactactatatcttagtgttgatatttttagttagtgtaatttat 176  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
35098546 aaataggtgtcagaattttagtatactactatatcttagtgttgatatttttggttagtgtaatttat 35098613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University