View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_low_197 (Length: 236)
Name: NF3772_low_197
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_low_197 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 17 - 221
Target Start/End: Complemental strand, 43877053 - 43876849
Alignment:
| Q |
17 |
aggaataattgattaaaaagttcatagtttaaaggtctaatagaaagaactatggcacaactcaatgactcttagatgagatgactccaacatggaaatg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43877053 |
aggaataattgattaaaaagttcatagtttaaaggtctaatagaaagaactattgcacaactcaatgactcttagatgagatgactccaacatggaaatg |
43876954 |
T |
 |
| Q |
117 |
caaaaacattaatagggacgagtttgtcaaatttgggttgtgtgcagtcacaatcatttgactgcacgtagtcggtatcatctggccgtttgatcaagat |
216 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43876953 |
caaaaacattaatagggacgagtttgacaaatttgggttgtgtgcagtcacaatcatttgactgcacgtagtcggtatcatctggccgtttgatcaagat |
43876854 |
T |
 |
| Q |
217 |
catac |
221 |
Q |
| |
|
||||| |
|
|
| T |
43876853 |
catac |
43876849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University