View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_low_205 (Length: 232)
Name: NF3772_low_205
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_low_205 |
 |  |
|
| [»] scaffold0044 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0044 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 21 - 217
Target Start/End: Original strand, 91827 - 92027
Alignment:
| Q |
21 |
aaattttccgaaaatggttgtactaatatcaccattgcacaaccatgaagcattaaccgtggtcgca----taactcgaaaaggtctgtaaatctccggc |
116 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
91827 |
aaattgtccgaaaatggttgtactaatatcaccattgcacaaccatgaagcattaaccgtggtcgcacgcataactcgaaaaggtctgtaaatctccggc |
91926 |
T |
 |
| Q |
117 |
aactactcggtcatttcatctttccgattgtggtatctcatgatttgggatatgcttgtgtttggttcttcaaaactcgcttgctaatggtccttcttca |
216 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
91927 |
acctactcggtcatttcatctttccgattgtggtatctcatgatttgggttgtgcttgtgtttggttcttcaaaactcgcttgctaatggtccttcttca |
92026 |
T |
 |
| Q |
217 |
t |
217 |
Q |
| |
|
| |
|
|
| T |
92027 |
t |
92027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University