View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_low_209 (Length: 229)
Name: NF3772_low_209
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_low_209 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 89 - 221
Target Start/End: Complemental strand, 28729001 - 28728869
Alignment:
| Q |
89 |
atctgtttttcatctgcagggccaaaatacgtgtgtgaattagatatcctaggattatagaagatgctagtttaagtacaatccatttcatagtacattt |
188 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28729001 |
atctgtttttcgtctgcagggccaaaatacgtgtgtgaattagatatactaggattatagaagaggctagtttaagtacaatccatttcatagtacattt |
28728902 |
T |
|
| Q |
189 |
cctcctggacatttttctttctccatctctgct |
221 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||| |
|
|
| T |
28728901 |
cctcctggtcatttttctttcgccatctctgct |
28728869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 28730053 - 28730008
Alignment:
| Q |
1 |
tttagtctttggggaagtatctgttttcacaggcttatgacttttg |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28730053 |
tttagtctttggggaagtatctgttttcacaggcttatgaattttg |
28730008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 51 - 85
Target Start/End: Complemental strand, 28730092 - 28730058
Alignment:
| Q |
51 |
gtatcaattcatggtttcttacaatttgtgtatga |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
28730092 |
gtatcaattcatggtttcttacaatttgtgtatga |
28730058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University