View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_low_214 (Length: 227)
Name: NF3772_low_214
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_low_214 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 66; Significance: 3e-29; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 7 - 80
Target Start/End: Complemental strand, 25990080 - 25990007
Alignment:
| Q |
7 |
gtcaatgctcacgtggatgtcgtggcacgcgctgattgtattaatattgttgacaatatattctttgatcattg |
80 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25990080 |
gtcaatgctcacgtggatgtcgtggcacacgctgattgtattaatattgttgacaatatattctttaatcattg |
25990007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 156 - 227
Target Start/End: Complemental strand, 25989919 - 25989848
Alignment:
| Q |
156 |
gtgcttttattgagttgcatgtaggaggttagatatgattgtcttcaggggattgcggatgaaatattgtca |
227 |
Q |
| |
|
|||||||||||||||||||| ||| |||||| ||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
25989919 |
gtgcttttattgagttgcatatagaaggttaaatatgattgtcttcaggggattgcggaagaattattgtca |
25989848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 157 - 227
Target Start/End: Complemental strand, 25994018 - 25993948
Alignment:
| Q |
157 |
tgcttttattgagttgcatgtaggaggttagatatgattgtcttcaggggattgcggatgaaatattgtca |
227 |
Q |
| |
|
||||||||||||| ||| | || |||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25994018 |
tgcttttattgagatgcttagagaaggttaaatatgattgtcttcgcaggattgcggatgaaatattgtca |
25993948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University