View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3772_low_214 (Length: 227)

Name: NF3772_low_214

Description: NF3772

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF3772_low_214

[»] chr3 (3 HSPs)

Target: chr3 (Bit Score: 66; Significance: 3e-29; HSPs: 3)

Name: chr3

Description:

Target: chr3; HSP #1

Raw Score: 66; E-Value: 3e-29

Query Start/End: Original strand, 7 - 80

Target Start/End: Complemental strand, 25990080 - 25990007

Alignment:

Q	7	gtcaatgctcacgtggatgtcgtggcacgcgctgattgtattaatattgttgacaatatattctttgatcattg	80	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|
T	25990080	gtcaatgctcacgtggatgtcgtggcacacgctgattgtattaatattgttgacaatatattctttaatcattg	25990007	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2

Raw Score: 52; E-Value: 6e-21

Query Start/End: Original strand, 156 - 227

Target Start/End: Complemental strand, 25989919 - 25989848

Alignment:

Q	156	gtgcttttattgagttgcatgtaggaggttagatatgattgtcttcaggggattgcggatgaaatattgtca	227	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\| \|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\| \|\|\|\|\|\|\|\|
T	25989919	gtgcttttattgagttgcatatagaaggttaaatatgattgtcttcaggggattgcggaagaattattgtca	25989848	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3

Raw Score: 35; E-Value: 0.00000000008

Query Start/End: Original strand, 157 - 227

Target Start/End: Complemental strand, 25994018 - 25993948

Alignment:

Q	157	tgcttttattgagttgcatgtaggaggttagatatgattgtcttcaggggattgcggatgaaatattgtca	227	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\| \| \|\| \|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	25994018	tgcttttattgagatgcttagagaaggttaaatatgattgtcttcgcaggattgcggatgaaatattgtca	25993948	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]