View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_low_220 (Length: 222)
Name: NF3772_low_220
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_low_220 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 13 - 204
Target Start/End: Complemental strand, 40668634 - 40668443
Alignment:
| Q |
13 |
ttatactaagaagaatatcatcaataattcataatataaacataaataaaaggtagtagccaatttatggtaattaaacttaatagtgtgaaataaatag |
112 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40668634 |
ttatactaaaaagaatatcatcaataattcataatataaacataaataaaaggtagtagccaatttatggtaattaaacttaatagtgtgaaataaatag |
40668535 |
T |
|
| Q |
113 |
cagacttgaagttttcccatttgaaagggaagtctagaaacacatcataaaaaacctaactatatagatcatcttcatctgcccctccagta |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40668534 |
cagacttgaagttttcccatttgaaagggaagtctagaaacacatcataaaaaacctaactatatagatcatcttcatctgcccctccagta |
40668443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University