View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_low_231 (Length: 205)
Name: NF3772_low_231
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_low_231 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 17 - 192
Target Start/End: Complemental strand, 35221461 - 35221288
Alignment:
| Q |
17 |
aaggtgatgacatttcagtttggtgtcataaatgaattgcaggatatgttactttaatcccaccatctcaaggtgattttcatctctctaacttaagggt |
116 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35221461 |
aaggtgatgacatttcagtttggtataataaatgaattgcaggatatgttactttaatcccaccatctcaaggtgattttcatctctctaacttaagggt |
35221362 |
T |
|
| Q |
117 |
gtcacacattgtatgctgcataatcacaagagttgggatgttccttttctggaatctatttttgatcaacaaattg |
192 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35221361 |
gt--cacattgtatgctgcataatcacaagagttgggatgttccttttctggaatctatttctgatcaacaaattg |
35221288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 123 - 190
Target Start/End: Complemental strand, 17062819 - 17062752
Alignment:
| Q |
123 |
cattgtatgctgcataatcacaagagttgggatgttccttttctggaatctatttttgatcaacaaat |
190 |
Q |
| |
|
||||||||| |||| |||| ||| |||||||| |||||||||| ||| ||||||||||||| ||||| |
|
|
| T |
17062819 |
cattgtatgttgcaagatcaaaagcgttgggatattccttttctagaagctatttttgatcagcaaat |
17062752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University