View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_low_232 (Length: 203)
Name: NF3772_low_232
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_low_232 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 14 - 101
Target Start/End: Complemental strand, 1807699 - 1807604
Alignment:
| Q |
14 |
cacagactcaagatccatgatgaaaatttga--------aaactaaaaagaaaccatttttagatgaccctttatgaatttagacacaacccaatt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1807699 |
cacagactcaagatccatgatgaaaatttgatgttttgaaaactaaaaagaaaccatttttagatgaccctttatgaatttagacacaacccaatt |
1807604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University