View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_low_87 (Length: 314)
Name: NF3772_low_87
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_low_87 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 19 - 296
Target Start/End: Original strand, 5354151 - 5354428
Alignment:
| Q |
19 |
aaatcgataccacactcactgcaaccaggactgattccgacgccggtgtcgtacccaccaccattaatcaaattcaaccttaattaaaatggaatatcaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5354151 |
aaatcgataccacactcactgcaaccaggactggttccgacgccggagtcgtacccaccaccattaatcaaattcaaccttaattgaaatggaatatcaa |
5354250 |
T |
 |
| Q |
119 |
aaacatttagtgtcaaacataaacgacactgatacggttttgccagtggattttccggcgacgatgagtaacttgcaatggtaggtgaattgagaagaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5354251 |
aaacatttagtgtcaaacataaacgacactgatacggttttgccagtggattttccggcgacgatgagtaacttgcaatggtaggtgaattgagaagaaa |
5354350 |
T |
 |
| Q |
219 |
gcgaaggtgatgatttgatgatgactcaaatgtaagcgagaagaaacaatagtgtgtggtgtagtgaagaaacaggga |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
5354351 |
gcgaaggtgatgatttgatgatgactcaaatgtacgcgagaagaaacaatagtgtgtggtgtactgaagaaataggga |
5354428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University