View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_low_90 (Length: 312)
Name: NF3772_low_90
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_low_90 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 52 - 253
Target Start/End: Complemental strand, 40001461 - 40001260
Alignment:
| Q |
52 |
ttatacgatgagtttttaaaactcattgttttgcaacaaaaagatgtctctagtgttccagaacataagctgtgttgtcgaacattttacgtgggtgtgt |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40001461 |
ttatacgatgagtttttaaaactcattgttttgcaacaaaaagatgtctctagtgttccagcacataagctgtgttgtcgaacattttacgtgggtgtgt |
40001362 |
T |
 |
| Q |
152 |
gggctgatcccacgtttcacccccttcaagtgtgtaaggcacgtgtcctttgatcaataaaatacaaaaagaaggtattaaaatggattaagaaatgtta |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40001361 |
gggctgatcccacgtttcacccccttcaagtgtgtaaggcacttgtcctttgatcaataaaatacaaaaagaaggtattaaaatggattaagaaatgtta |
40001262 |
T |
 |
| Q |
252 |
gt |
253 |
Q |
| |
|
|| |
|
|
| T |
40001261 |
gt |
40001260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 312
Target Start/End: Complemental strand, 40001247 - 40001215
Alignment:
| Q |
280 |
taaggcacttgcattttccatttgaatactttc |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40001247 |
taaggcacttgcattttccatttgaatactttc |
40001215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University