View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_low_93 (Length: 304)
Name: NF3772_low_93
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_low_93 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 83; Significance: 2e-39; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 201 - 287
Target Start/End: Original strand, 30804083 - 30804169
Alignment:
| Q |
201 |
ttcccgccagaataatgcgaattgcagagatatcctcaccggagttccgaacactccacggcgacagcgacgatcatcacatcctct |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30804083 |
ttcccgccagaataatgcgaattgcagagatatcctcaccggagctccgaacactccacggcgacagcgacgatcatcacatcctct |
30804169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 10 - 67
Target Start/End: Original strand, 30803823 - 30803881
Alignment:
| Q |
10 |
attatactaacggttaaatttgatatata-ttttttgggttgaaataacatagctctaa |
67 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30803823 |
attatactaacggttaaatttgatatatatttttttgggttgaaataacatagctctaa |
30803881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 86 - 125
Target Start/End: Original strand, 30803967 - 30804006
Alignment:
| Q |
86 |
gtcgacaacagctataaatttagtacaatgttgaatgggt |
125 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
30803967 |
gtcgacaacagctctaaatttagtacaatgttgaacgggt |
30804006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University