View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3772_low_98 (Length: 301)
Name: NF3772_low_98
Description: NF3772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3772_low_98 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 16 - 246
Target Start/End: Original strand, 50153784 - 50154014
Alignment:
| Q |
16 |
tgctcctgtcttgcatggattctggcagtttcattgttcttctgatttcagcaacttttaagctagaacaaggttgaaattaaacgtatatatatcatgt |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| ||||||||||| |||||||||| |||| |
|
|
| T |
50153784 |
tgctcatgtcttgcatggattctggcagtttcattgttcttctgatttcaacaacttttaagttagaacaagattgaaattaaatgtatatatattatgt |
50153883 |
T |
|
| Q |
116 |
taagtatactttgaaaggtggaaaggacatgaaaataagtgtatcatgtgcgtcatcattatgtgtcctgcatcttattaccacatgaaatacttctata |
215 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
50153884 |
taagtatactttgaaaggtggaaatgacatgaaaataagtgtatcatgtgtgtcatcattatgtgtcctgcatcttagtaccacatgaaatatttctata |
50153983 |
T |
|
| Q |
216 |
aatatctcaatgtatatatgtaagcatacta |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
50153984 |
aatatctcaatgtatatatgtaagcatacta |
50154014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University