View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3775_high_9 (Length: 254)
Name: NF3775_high_9
Description: NF3775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3775_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 12 - 238
Target Start/End: Complemental strand, 40184750 - 40184524
Alignment:
| Q |
12 |
aggagcagagaaggaggaatgttgagaaatagaaaaaatactctctttttgattgtggtaatcatgactatatccacccaacaagcactagagagtagat |
111 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40184750 |
aggaccagacaaggaggaatgttgagaaatagaaaaaatactctctttttgattgtggtaatcatgactacatccacccaacaagcactagagagtagag |
40184651 |
T |
 |
| Q |
112 |
accaattaacattttgccccaagattgaagcattttgttaaagataaataaagagctcttatacattgccttggtcaaatttgctttctttccattcacc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40184650 |
accaattaacattttgccccaagattgaagcattttgttaaagataaataaagagctcttatacattgccttggtcaaatttgctttctttccattcacc |
40184551 |
T |
 |
| Q |
212 |
atgctttttcccttgtgattatcttct |
238 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
40184550 |
atgctttttcccttgtgattatgttct |
40184524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University