View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3775_low_14 (Length: 224)
Name: NF3775_low_14
Description: NF3775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3775_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 63 - 205
Target Start/End: Original strand, 54621817 - 54621959
Alignment:
| Q |
63 |
caataatagtttgagaaaatgacataactcaaggtaatgatatgtgctagagtcgtgttggtgtcggataccaaaagtatcagacataagacacgcctaa |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
54621817 |
caataatagtttgagaaaatgacataactcaaggtaatgatatgtgccagagtcgtgttggtgtcggataccaaaagtatcagacacaagacacgcctaa |
54621916 |
T |
|
| Q |
163 |
tatgaggagtattcgtgcttggtggaaaggcacccatgttatt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54621917 |
tatgaggagtattcgtgcttggtggaaaggcacccatgttatt |
54621959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 130
Target Start/End: Complemental strand, 19613665 - 19613600
Alignment:
| Q |
65 |
ataatagtttgagaaaatgacataactcaaggtaatgatatgtgctagagtcgtgttggtgtcgga |
130 |
Q |
| |
|
|||||| ||||||||||| |||||| |||| ||||||||||||| ||| ||| || ||||||||| |
|
|
| T |
19613665 |
ataataatttgagaaaataacataattcaatgtaatgatatgtgttagtatcgcgtcggtgtcgga |
19613600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University