View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3775_low_6 (Length: 344)
Name: NF3775_low_6
Description: NF3775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3775_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 18 - 330
Target Start/End: Original strand, 10595472 - 10595784
Alignment:
| Q |
18 |
agatcagccagtgaaaatctagttctgtctgttcttggtaacctttccaaacaaacatgattcctggatacagaaacatggactcatacccatttcaaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10595472 |
agatcagccagtgaaaatctagttctgtctgttcttggtaacctttccaaacaaacatgattcctggatacagaaacatggactcatacccatttcaaag |
10595571 |
T |
 |
| Q |
118 |
aaaccaaataccattccctcattaccatcatcctggcattgaacttgttcctcctcaaatgaccaaatcacccttcccttatgaacaaccttggccttat |
217 |
Q |
| |
|
||||||||||||||||||| |||| || ||||| |||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10595572 |
aaaccaaataccattcccttattatcaccatccaagcatggaacctgttcctcctcaaatgaccaaatcacccttcccttatgaacaaccttggccttat |
10595671 |
T |
 |
| Q |
218 |
gctagcaattataaccaccctataccaccacatttctgccatggtcacaataattacccttgttacaatagtcacataccttcttatcctcctcatgttc |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10595672 |
gctagcaattataaccaccctataccaccacatttctgctatggccacaataattacccttgttacaatagtcacataccttcttatcctcctcatgttc |
10595771 |
T |
 |
| Q |
318 |
cctctccatcacc |
330 |
Q |
| |
|
||||||||||||| |
|
|
| T |
10595772 |
cctctccatcacc |
10595784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University