View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3776_low_10 (Length: 236)
Name: NF3776_low_10
Description: NF3776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3776_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 110 - 221
Target Start/End: Complemental strand, 45318118 - 45318007
Alignment:
| Q |
110 |
gtgaggagggaccagttttatccaacaaaacagggatggtatggcacagttgattcacagaaatatataatatccaccaaacgcgtcacttttttattag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45318118 |
gtgaggagggaccagttttatccaacaaaacagggatggtatggcacagttgattcacagaaatatataatatccaccaaacgcgtcacttttttattag |
45318019 |
T |
|
| Q |
210 |
ttgtacaaaaac |
221 |
Q |
| |
|
|||||||||||| |
|
|
| T |
45318018 |
ttgtacaaaaac |
45318007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 45318228 - 45318177
Alignment:
| Q |
1 |
atgtagtttaatagaaaatgaacacatg-aggtgagtattattagtattgtg |
51 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45318228 |
atgtagtttaatagaaaatgaacacatgaaggtgagtattattagtattgtg |
45318177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University