View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3776_low_11 (Length: 236)
Name: NF3776_low_11
Description: NF3776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3776_low_11 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 44 - 236
Target Start/End: Complemental strand, 48008644 - 48008454
Alignment:
| Q |
44 |
ttgagaaatgtctagtattagttgatcactgagcaactcattatgtcacaccaaaaactggatcgagatatgctgcaacagcacgtagttttatgttgta |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
48008644 |
ttgagaaatgtctagtattagttgatcactgagcaactcattatgtcacaccaaaaactggatccagatatgctgcaacagcacgtagttttatgttct- |
48008546 |
T |
 |
| Q |
144 |
aaatgatttcagccgttaatttgaggttaaatgttttgatttcagtcgttgatttaggtcgaaccggcaaaaatacagtgacgttattatctc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
48008545 |
aaatgatttcagccgttaatttgaggttaaatgtttcgatttcagtcgttgatttaggtcgaa-cggcaaaaagacagtgacgttattatctc |
48008454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University