View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3777_low_7 (Length: 236)
Name: NF3777_low_7
Description: NF3777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3777_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 13 - 219
Target Start/End: Complemental strand, 32199268 - 32199062
Alignment:
| Q |
13 |
gagagttggaaaattgaggttgttagattaaatgtttaatagtagatttggcattatgttccacgggtatttggacataatggagttggagatttggtag |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32199268 |
gagagttggaaaattgaggttgttagattaaatgtttaatactcgatttggcattatgttccacgggtatttggacataatggagttggagatttggtag |
32199169 |
T |
 |
| Q |
113 |
ttttgcgcatgttcaagttcaaatgatttcttactaaagaagaaaggtggacattgttcacatataatcatattatgaacgaatatcggtggtttgacta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32199168 |
ttttgcgcatgttcaagttcaaatgatttcttactaaagaagaaaggtggacattgttcacatataatcatattatgaacgaatatcggtagtttgacta |
32199069 |
T |
 |
| Q |
213 |
aacttat |
219 |
Q |
| |
|
||||||| |
|
|
| T |
32199068 |
aacttat |
32199062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University