View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3778_low_6 (Length: 314)
Name: NF3778_low_6
Description: NF3778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3778_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 36 - 232
Target Start/End: Complemental strand, 35973462 - 35973266
Alignment:
| Q |
36 |
ggttgaatgattatgtatatgtgcaggggtgaaattggaatttgaggaaagttttactaccttagacggcggtagcgaacataacggcggcgaggaaagc |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35973462 |
ggttgaatgattatgtatatgtgcaggggtgaaattggaatttgaggaaagttttgctaccttagacggcggtagcgaacataacggcggcgaggaaagc |
35973363 |
T |
 |
| Q |
136 |
cgagagctaaggaaaagcttcggcggagttgttgacgtggagcggaagctagcataaccagaagggtagaacagtaaataacccgagcaagagcaac |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35973362 |
cgagagctaaggaaaagcttcggcggagttgttgacgtggagcggaagctagcataaccagaagggtagaacagtaaataacccgagcaagagcaac |
35973266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University