View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3779_high_15 (Length: 203)
Name: NF3779_high_15
Description: NF3779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3779_high_15 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 3e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 17 - 203
Target Start/End: Original strand, 50372368 - 50372554
Alignment:
| Q |
17 |
agctttaacccatgcccatgcaactgagttttgttggagttattctagctagtcctagtttattttggttcaattacagagacgacggtaactataatta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50372368 |
agctttaacccatgcccatgcaactgagttttgttggagttattctagctagtcctagtttattttggttcaattacagagacgacggtaactatgatta |
50372467 |
T |
|
| Q |
117 |
ccgtacctacactttctgttgttattcccttttcactaagaattcagaatgctttcctttgttcctcttacatttccttcaatttcc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50372468 |
ccgtacctacactttctgttgttattcccttttcactaagaattcagaatgctttcctttgttcctcttacatttccttcaatttcc |
50372554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University