View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3779_low_4 (Length: 377)
Name: NF3779_low_4
Description: NF3779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3779_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 108 - 362
Target Start/End: Original strand, 25016118 - 25016372
Alignment:
| Q |
108 |
ttaagatggactcactcttcctaagccaaggtagtgagcaacaatggcagcaggaatggcagggaagagaatggacagcttggtaccaagaataacctct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25016118 |
ttaagatggactcactcttcctaagccaaggtagtgagcaacaatggcagcaggaatggcagggaagagaatggacagcttggtaccaagaataacctct |
25016217 |
T |
|
| Q |
208 |
tggatgttaaccaacacgttccggagcgaagcacatcgaatcctcgacacaagagcgtgatcagatttcttgcgcaaggaagaagaagacatgccatgcg |
307 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25016218 |
tggatgttaaccaaaacgttccggagcgaagcacatcgaatccttgacacaagagcgtgatcagatttcttgcgcaaggaagaagaagacatgccatgcg |
25016317 |
T |
|
| Q |
308 |
cggtccggctccggccatgtccatgtctagcttccttggtcaagacctttggatt |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25016318 |
cggtccggctccggccatgtccatgtctagcttccttggtcaagacctttggatt |
25016372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University