View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3779_low_9 (Length: 261)
Name: NF3779_low_9
Description: NF3779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3779_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 23 - 250
Target Start/End: Original strand, 8029073 - 8029300
Alignment:
| Q |
23 |
tccagaataccaagtcttcatgaatgatcttcaagggaatgatttcaacaatatttttaggttacttgataggttcacagagaaactaaatgatgaagtg |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8029073 |
tccagaataccaagtcttcatgaatgatcttcaagggaatgatttcaacaacatttttaggttacttgataggttcacagagaaactaaatgatgaagtg |
8029172 |
T |
 |
| Q |
123 |
gaagatgggattggtggtccaatctttttctatggggctcctggttctttttatggcagaatttttccaacaaaaacaatgcatttcattcattcctctt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8029173 |
gaagatgggattggtggtccaatctttttctatggggctcctggttctttttatggcaggatttttccaacaaaaacaatgcatttcattcattcctctt |
8029272 |
T |
 |
| Q |
223 |
acagccttcaatggctctcacaggttct |
250 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
8029273 |
acagccttcaatggctctcacaggttct |
8029300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 150 - 191
Target Start/End: Complemental strand, 27736751 - 27736710
Alignment:
| Q |
150 |
ttctatggggctcctggttctttttatggcagaatttttcca |
191 |
Q |
| |
|
|||||||| | ||||||||| ||||||||||||||||||||| |
|
|
| T |
27736751 |
ttctatggagttcctggttcattttatggcagaatttttcca |
27736710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University