View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3780_high_6 (Length: 300)
Name: NF3780_high_6
Description: NF3780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3780_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 5e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 14 - 132
Target Start/End: Complemental strand, 42225205 - 42225087
Alignment:
| Q |
14 |
tctactggctagctacttttccttttctcgtgctaattgtttatcgattctggcgatgtggtgttctttcttttaccaggaaaataaaatgctccattat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42225205 |
tctactggctagctacttttccttttctcgtgctaattgtttatcgattctggctatgtggtgttctttcttttaccagtaaaataaaatgctccattat |
42225106 |
T |
 |
| Q |
114 |
tgtatttatgcatgtcacc |
132 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
42225105 |
tgtatttatgcatgtcacc |
42225087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 215 - 286
Target Start/End: Complemental strand, 42225004 - 42224933
Alignment:
| Q |
215 |
cgtcacatcgaattattaacggtatgattttatgctctctcgcgtgacactaagctttggccacagaaactt |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42225004 |
cgtcacatcgaattattaacggtatgattttatgctctctcgcgtgacactaagctttggccacataaactt |
42224933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University