View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3781_high_28 (Length: 255)
Name: NF3781_high_28
Description: NF3781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3781_high_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 16 - 237
Target Start/End: Complemental strand, 3981278 - 3981043
Alignment:
| Q |
16 |
acacaccctatcctcatcgccacgtcatactgagatgaagattgtgacatactg---------agatgatgcacaattttctgacatgcttcccaagtaa |
106 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3981278 |
acacaccctatcctcatcgccacatcatactgagatgaagattgtgacacacaccaaataagaagatgatgcacaattttctgacatgcttcccaagtaa |
3981179 |
T |
 |
| Q |
107 |
caattttcttcttatttgaacattatgtgatcgtcaaaattgaaaacg-----tttacgtttaatttaatcagagacttttatattgttttggttttgat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3981178 |
caattttcttcttatttgaacattatgtgatcgtcaaaattgaaaacgtttagtttacgtttaatttaatcagagacttttatattattttggttttgat |
3981079 |
T |
 |
| Q |
202 |
atataatggaaatacggaatgatacctactactatc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
3981078 |
atataatggaaatacggaatgatacctactactatc |
3981043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University