View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3781_high_38 (Length: 236)
Name: NF3781_high_38
Description: NF3781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3781_high_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 218
Target Start/End: Original strand, 49858147 - 49858348
Alignment:
| Q |
17 |
cataggatcttgggatagaaaattctattttgtgatggaaatccaactcaatctaaaaattcaattttttagttaattaacttagtaaaggagattggtt |
116 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
49858147 |
cataggagcttgggatagaaaattctattttgtgatggaaatccaactcaatctaaaaattcaattttttagctaattaacttagtaaaggagattggtt |
49858246 |
T |
|
| Q |
117 |
attaactctagtctcctgtgggatcaatatcttttactacacaataaaactgtgcaattataggcttatcagcaaccaatgagaattcatcaatgagttt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49858247 |
attaactctagtctcctgtgggatcaatatcttttactacacaataaaactgtgcaattataggcttatcagcaaccaatgagaattgatcaatgagttt |
49858346 |
T |
|
| Q |
217 |
tc |
218 |
Q |
| |
|
|| |
|
|
| T |
49858347 |
tc |
49858348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University