View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3781_low_26 (Length: 287)
Name: NF3781_low_26
Description: NF3781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3781_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 39 - 255
Target Start/End: Complemental strand, 18417800 - 18417584
Alignment:
| Q |
39 |
atctgaccaaagtaaaggcagttccctcggaatcgaattattcaacttcattttaacttatgacaagaatttgtggtactgcagttttacatctgttact |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18417800 |
atctgaccaaagtaaaggcagttccctcggaatcgaattattcaacttcattttaacttataacaagaatttgtggtactgcagttttacatctgttact |
18417701 |
T |
 |
| Q |
139 |
aacaaattgatttctgattgtgtaaactcttattgctgcaggtaaaaagaacaacaactgtgttatttatggtggtgtaaagtttaattgccacgtagtt |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18417700 |
aacaaattgatttctgattgtgtaaactcttattgctgcgggtaaaaagaacaacaactgtgttatttatggtggtgtaaactttaattgccacgtagtt |
18417601 |
T |
 |
| Q |
239 |
aaggaacataaataaat |
255 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
18417600 |
aaggaacataaataaat |
18417584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University