View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3781_low_27 (Length: 282)

Name: NF3781_low_27
Description: NF3781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3781_low_27
NF3781_low_27
[»] chr3 (1 HSPs)
chr3 (1-209)||(52365784-52365992)


Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 52365992 - 52365784
Alignment:
1 aataatataattggtgagtatgcatgtatgaataataatcaggttattcatgtgcaacaaacattttggatagatattcttaaagttaagattggaatca 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
52365992 aataatataattggtgagtatgcatgtatgaataataatcaggttattcatgtgcaacaaacattttggatagatattcttaaagttaagataggaatca 52365893  T
101 ctcaactttacattactagcttgaaggtgagagaagtttcctacttataaacatataaatattttgtaatcatcttcttctcttatatttattttaatta 200  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52365892 ctcaactttacattactagcttgaaggtgagagatgtttcctacttataaacatataaatattttgtaatcatcttcttctcttatatttattttaatta 52365793  T
201 ctgcattac 209  Q
    |||||||||    
52365792 ctgcattac 52365784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University