View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3781_low_29 (Length: 266)
Name: NF3781_low_29
Description: NF3781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3781_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 17 - 247
Target Start/End: Original strand, 47619773 - 47620003
Alignment:
| Q |
17 |
cctcctacgttgagtttgtcgacgccttctttcccacgccatgtctcctggtgttccacacattgatagttgctttgttagacgtttccttttcttaaac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47619773 |
cctcctacgttgagtttgtcgacgccttctttcccacgccatgtctcctggtgttccacacattgatagttgctttgttagacgtttccttttcttaaac |
47619872 |
T |
 |
| Q |
117 |
gccaatgcctcggccttctgatcagaatgttcctgttgcaactcttcctcttgatctgaaaactcgttttcgcagactcctcctccctgtaacactattt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47619873 |
gccaatgcctcggccttctgatcagaatgttcctgttgcaactcttcctcctgatctgaaaactcgttttcgcagactcctcctccctgtaacactattt |
47619972 |
T |
 |
| Q |
217 |
cctcgctactcataatattaattatgaattt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
47619973 |
cctcgctactcataatattaattatgaattt |
47620003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University