View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3781_low_34 (Length: 250)
Name: NF3781_low_34
Description: NF3781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3781_low_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 45650926 - 45651108
Alignment:
| Q |
1 |
atatagaatgaaataattaagaagccgcctgtgaacaacagtatgcatgcttataagaagaagaatggtacacgttaggtatgtgagtacgtgggaatgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45650926 |
atatagaatgaaataattaagaagccgcctgtgaacaacagtatgc----ttataagaagaagaatggtacacgttaggtatgtgagtacgtgggaatgc |
45651021 |
T |
 |
| Q |
101 |
ttagaatctttgctaaaggaagataaacacgggccatgctcaatatattcaaacctactccttgaatatagtagggattagatatca |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45651022 |
ttagaatctttgctaaaggaagataaacacgggccatgctcaatatattcaaacctactccttgaatatagtagggattagatatca |
45651108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University