View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3781_low_35 (Length: 250)
Name: NF3781_low_35
Description: NF3781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3781_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 36956226 - 36956463
Alignment:
| Q |
1 |
aggtagtgcataacatctatccatgaatttatgggaactgatttaatttttataaggctaatatttatgagtgtaattgggaccatatgnnnnnnnggtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36956226 |
aggtagtgcataacatctatccatgaatt-atgggaattgatttaatttttataaggctaatatttatgagtgtaattgggaccatatgtttttttggtt |
36956324 |
T |
 |
| Q |
101 |
ggtgtcaaacatgaaatgatactatgagtcaagattacttttcaaactttgatttcattaattatgaagtttcaaatacatgtacggtcggacctttata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36956325 |
ggtgtcaaacatgaaatgatactatgagtcaagattacttttcaaactttgatttcattaattatgaagtttcaaatacatgtacggtcggacctttata |
36956424 |
T |
 |
| Q |
201 |
tgttgtgtttaacaagacaaattattccactcgagtatt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36956425 |
tgttgtgtttaacaagacaaattattccactcgagtatt |
36956463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University