View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3781_low_43 (Length: 232)
Name: NF3781_low_43
Description: NF3781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3781_low_43 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 45650303 - 45650534
Alignment:
| Q |
1 |
tatactctgattaatgtatatctatagaagtcccaacttgcatccaaatcataggtctgatcacgtttttaatttaaattatatgcttgt--tatattac |
98 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45650303 |
tatactttgattaatgtat--ctatagaagtcccaacttgcatccaaatcataggtctgatcacgtttttaatttaaattatatgcttgttatatattac |
45650400 |
T |
|
| Q |
99 |
ctgcttattatgactatttcttgttttaattctcgtcaatttcttccacagaatannnnnnnnnnnnnnnacaaagtttttatatcttctacggagtaag |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45650401 |
ctgcttattatgactatttcttgttttaattctcgtcaatttcttccacagaatattttttcatttttttacaaagtttttatatcttctacggagtaag |
45650500 |
T |
|
| Q |
199 |
ttatagattcgctgttttaagtaaatcaatttat |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45650501 |
ttatagattcgctgttttaagtaaatcaatttat |
45650534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University