View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3781_low_45 (Length: 229)

Name: NF3781_low_45
Description: NF3781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3781_low_45
NF3781_low_45
[»] chr5 (1 HSPs)
chr5 (35-215)||(41739793-41739973)


Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 35 - 215
Target Start/End: Complemental strand, 41739973 - 41739793
Alignment:
35 cgtatatatggacaagcgcttctaaagtgaacaattcattttagagagtaaattgaggaatattaaccgtgataagcaaattaatatgtgcatcaaccat 134  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
41739973 cgtatatatggacaagcgcttctaaagtgaacaattcattttagagaggaaattgaggaatattaaccgtgataagcaaattaatatgtgcatcaaccat 41739874  T
135 tgatttctcactttactaatactaattactcactttagaggaatcaatcctcgtttatatctacaaattgtcaaactctct 215  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41739873 tgatttctcacttcactaatactaattactcactttagaggaatcaatcctcgtttatatctacaaattgtcaaactctct 41739793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University