View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3781_low_45 (Length: 229)
Name: NF3781_low_45
Description: NF3781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3781_low_45 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 35 - 215
Target Start/End: Complemental strand, 41739973 - 41739793
Alignment:
| Q |
35 |
cgtatatatggacaagcgcttctaaagtgaacaattcattttagagagtaaattgaggaatattaaccgtgataagcaaattaatatgtgcatcaaccat |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41739973 |
cgtatatatggacaagcgcttctaaagtgaacaattcattttagagaggaaattgaggaatattaaccgtgataagcaaattaatatgtgcatcaaccat |
41739874 |
T |
 |
| Q |
135 |
tgatttctcactttactaatactaattactcactttagaggaatcaatcctcgtttatatctacaaattgtcaaactctct |
215 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41739873 |
tgatttctcacttcactaatactaattactcactttagaggaatcaatcctcgtttatatctacaaattgtcaaactctct |
41739793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University