View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3781_low_48 (Length: 208)
Name: NF3781_low_48
Description: NF3781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3781_low_48 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 17 - 195
Target Start/End: Complemental strand, 42845959 - 42845781
Alignment:
| Q |
17 |
agattcaggtaggaaactctgaataagttctgcaagcatgttatccatgcctctttctttgagtgctcagcaatttcattgacgtttgcacggctcatag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42845959 |
agattcaggtaggaaactctgaataagttctgcaagcatgttatccatgcctctttctttgagtgctcagcaatttcattgacgtttgcacggctcatag |
42845860 |
T |
|
| Q |
117 |
cctcccagtacaaaaaatccattgtcatttctgtcttttctctcttccctgccttagctgcttgtgcatgtatattctt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42845859 |
cctcccagtacaaaaaatccattgtcatttctgtcttttctctcttccctgccttagctgcttgtgcatgtatattctt |
42845781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 43 - 175
Target Start/End: Complemental strand, 41980056 - 41979923
Alignment:
| Q |
43 |
gttctgcaagcatgttatccatgcctctttctttgagtgc-tcagcaatttcattgacgtttgcacggctcatagcctcccagtacaaaaaatccattgt |
141 |
Q |
| |
|
|||| ||||||||||| | |||||| || ||||||| ||| ||||||||||| ||||||||||| || |||| ||| ||||||| ||| | ||||| | |
|
|
| T |
41980056 |
gttcagcaagcatgttgttcatgcccctctctttgattgcatcagcaatttccttgacgtttgcccgtctcacagcttcccagtccaatgagtccatgtt |
41979957 |
T |
|
| Q |
142 |
catttctgtcttttctctcttccctgccttagct |
175 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| |
|
|
| T |
41979956 |
gctttctgtcttttctctcttcccagccgtagct |
41979923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University