View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3782_high_3 (Length: 351)
Name: NF3782_high_3
Description: NF3782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3782_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 166 - 279
Target Start/End: Complemental strand, 43378071 - 43377957
Alignment:
| Q |
166 |
agggaaacgaacttatgtcgtgtaatattagcaaatgtggaatagcttattagggat-acatcaagatcatgaatatcaattgtatatgtagcaactcga |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43378071 |
agggaaacgaacttatgtcgtgtaatattagcaaatgtggaatagcttattagggataacatcaagatcatgaatatcaattgtatatgtagcaactcga |
43377972 |
T |
|
| Q |
265 |
atgagctcatgagtc |
279 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
43377971 |
atgagctcatgagtc |
43377957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University