View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3782_high_4 (Length: 351)
Name: NF3782_high_4
Description: NF3782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3782_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 16 - 348
Target Start/End: Complemental strand, 41335661 - 41335327
Alignment:
| Q |
16 |
aatttcactatatatatcgcaaattaaaccaatcatccaagaaaacaaactttattctattgnnnnnnnaaaaaggggcata-----atgtgtaaatatt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |||| |||||||| |
|
|
| T |
41335661 |
aatttcactatatatatcgcaaattaaaccaatcatccaagaaaacacactttattctattgtttttt-aaaaaggggcatacaccaatgtataaatatt |
41335563 |
T |
 |
| Q |
111 |
acgaccgaagtacatttctctttcggttgtaggcaaggggtgaacacaaaattgagacaaatcatacatgtctttaaccatattttttaaactttgatcg |
210 |
Q |
| |
|
|||||||||||||||||||||||| | | ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41335562 |
acgaccgaagtacatttctctttcagatctaggcaaggggcgaacacaaaattgagacaaatcatacatgtctttaaccatatttt--aaactttgatcg |
41335465 |
T |
 |
| Q |
211 |
gatcaattctttacactgacatgtccttaccctgggagactacgagtaaccccaacagcgcctaacgttgcgttgccggggtcttcactttcagacacac |
310 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41335464 |
gatcaattctttacactaacatgtccttaccctgggagactacgagtaaccccgacagcgcctaacgttgcgttgccggggtcttcactttcagacacac |
41335365 |
T |
 |
| Q |
311 |
catcaccggtttttacaatcctcatttgagtctctgct |
348 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41335364 |
catcaccagtttttacaatcctcatttgagtctctgct |
41335327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University