View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3782_low_6 (Length: 332)
Name: NF3782_low_6
Description: NF3782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3782_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 102 - 318
Target Start/End: Complemental strand, 40180225 - 40180009
Alignment:
| Q |
102 |
catgctaatcaaacattattgcaaccactaaaattgcatgatttgtaatatcacaggtcaaactaaacgatttgaacagcttaaaaggttgatattaata |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40180225 |
catgctaatcaaacattattgcaaccactaaaattgcatgatttgtaatatcacaggtcaaactaaacgatttgaacagcttaaaaggttgatattaata |
40180126 |
T |
|
| Q |
202 |
tattattaacaggagtgacaagaattagaaaagttgcaaaactgagttgatttcatttacctggatcgtagttcccttggaaaaatgggtgtggcggtct |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40180125 |
tattattaacaggagtgacaagaattagaaaagttgcaaaactgagttgatttcatttacctggatcatagttcccttggaaaaatgggtgtggcggtct |
40180026 |
T |
|
| Q |
302 |
ctctgcttatcagtgca |
318 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
40180025 |
ctctgcttatcagtgca |
40180009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University