View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3782_low_7 (Length: 313)
Name: NF3782_low_7
Description: NF3782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3782_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 22 - 213
Target Start/End: Complemental strand, 51811761 - 51811570
Alignment:
| Q |
22 |
ccatcattggggatgctcataattgatgacaagaacgcagattgacccaatacataccaaaagtcttcgtggcgatcatttttaaagtaaccatataact |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51811761 |
ccatcattggggatgctcataattgatgacaagaacgcaggttgacccaatacataccaaaagtctttgtggcgatcatttttaaagtaaccatataact |
51811662 |
T |
 |
| Q |
122 |
ttgtcaatcttcaagtacatttaacatcgttcaccaaaatattgatgaagttaggtgagtaattttgaatcttacattgaagagaattattc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51811661 |
ttgtcaatcttcaagtacatttaacatcgttcaccaaaatattgatgaagttaggtgagtaattttgaatcttacattgaagagaattattc |
51811570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 243 - 303
Target Start/End: Complemental strand, 51811541 - 51811481
Alignment:
| Q |
243 |
caatctcactgatatgaccaatgcaatccaccacaaaaccattctcaaaactactcctttg |
303 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51811541 |
caatcccactgatatgatcaatgcaatccaccacaaaaccattctcaaaactactcctttg |
51811481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University