View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3784_high_10 (Length: 287)
Name: NF3784_high_10
Description: NF3784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3784_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 77; Significance: 9e-36; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 35013528 - 35013432
Alignment:
| Q |
1 |
agtacgcgtacaacggccaaaggaacaaatgacttacttatcttgagacggatggagcacaatttcccaattcctttgacagatgagtgacacgtgg |
97 |
Q |
| |
|
|||||||||||||| |||||| || |||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35013528 |
agtacgcgtacaacagccaaatgagcaaatgacttacttattttgagacggatggagcacaatttcccaattcctttgatagatgagtgacacgtgg |
35013432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University