View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3784_low_19 (Length: 232)

Name: NF3784_low_19
Description: NF3784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3784_low_19
NF3784_low_19
[»] chr2 (1 HSPs)
chr2 (23-226)||(36946034-36946236)
[»] chr4 (1 HSPs)
chr4 (35-199)||(17768830-17768993)


Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 23 - 226
Target Start/End: Original strand, 36946034 - 36946236
Alignment:
23 aaggcatctgcaacaccacttacttatgttgacactgaggacatctgtggaaggcctttgggactcagactttgacaagaaaactggtgatttatacatt 122  Q
    |||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||     
36946034 aaggcatctgcaacaccacttagttatgttgaaactgaggacatctgtggaaggcctttgggactcaga-tttgacaagaaaactggtgatttatacata 36946132  T
123 gcagatgcatattttgggctgatgaaggtggggcctcaaggtggtttcataacatctcttgcaaccgaggcagaaggagtaccgtttagatttactgatg 222  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||||  |||||||||||||||||| |||||||||||||| |||||||||||| |||    
36946133 gcagatgcatatttcgggcttatgaaggtggggcctcaaggtggtttcgcaacatctcttgcaaccgaagcagaaggagtaccatttagatttactaatg 36946232  T
223 atgt 226  Q
    ||||    
36946233 atgt 36946236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 35 - 199
Target Start/End: Complemental strand, 17768993 - 17768830
Alignment:
35 acaccacttacttatgttgacactgaggacatctgtggaaggcctttgggactcagactttgacaagaaaactggtgatttatacattgcagatgcatat 134  Q
    |||||| ||| ||||||  | |||||| |||| |||||||||||||||||||||||| || ||||||||||| ||||| || ||||||||||||||||||    
17768993 acaccatttagttatgtgaagactgagcacatatgtggaaggcctttgggactcaga-ttcgacaagaaaacaggtgaattgtacattgcagatgcatat 17768895  T
135 tttgggctgatgaaggtggggcctcaaggtggtttcataacatctcttgcaaccgaggcagaagg 199  Q
     |||||||| |||||||||||||  | || |||||   ||||||||||||||| ||||| |||||    
17768894 cttgggctgttgaaggtggggcccgagggaggtttagcaacatctcttgcaactgaggctgaagg 17768830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University