View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3785_high_3 (Length: 367)
Name: NF3785_high_3
Description: NF3785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3785_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 10 - 185
Target Start/End: Complemental strand, 49417472 - 49417297
Alignment:
| Q |
10 |
ataattctacatgtatagaaaattagattgaaattgggtgtaaaaaacgacataatgtggtcactacataatgtgccaagttgacgaatgtagtagttaa |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49417472 |
ataattttacatgtatagaaaattagattgaaattgggtgtaaaaaacgacataatgtggtcactacataatgtgccaagttgaagaatgtagtagttaa |
49417373 |
T |
|
| Q |
110 |
tatcatcttattatgtttaatgaacacttgccatgtctatcatatcttttgttagctgagcgtccctttcaagttt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
49417372 |
tatcatcttattatgtttaatgaacacttgccatgtctatcatatcttttgttagctgagcgtccttttcaagttt |
49417297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University