View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3786_high_11 (Length: 229)
Name: NF3786_high_11
Description: NF3786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3786_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 127 - 211
Target Start/End: Original strand, 38387492 - 38387576
Alignment:
| Q |
127 |
catgatgttaaattcattgaaatcacaatgaatgagaccatgttctgctagccgaataattataccgataattgtctcaaaaact |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38387492 |
catgatgttaaattcattgaaatcacaatgaatgagaccatgttctgccagccgaataattataccaataattgtctcaaaaact |
38387576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 17 - 123
Target Start/End: Original strand, 38387255 - 38387361
Alignment:
| Q |
17 |
aagggacgtgatagcatacaaggaagagactcttgcatctttgcattacagtgtgacacatacaccatttgcggaaaatcaatcacggtaactttttctt |
116 |
Q |
| |
|
||||||| | ||| ||| ||||||||| ||||| |||||||||||||| ||| |||||| |||||||||| |||||||||||||| |||| |||||||| |
|
|
| T |
38387255 |
aagggacataataccatgcaaggaagaagctcttacatctttgcattacggtgcgacacagacaccatttgtggaaaatcaatcacagtaattttttctt |
38387354 |
T |
 |
| Q |
117 |
catcgtc |
123 |
Q |
| |
|
||||||| |
|
|
| T |
38387355 |
catcgtc |
38387361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University