View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3786_high_8 (Length: 267)
Name: NF3786_high_8
Description: NF3786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3786_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 8 - 261
Target Start/End: Original strand, 1156568 - 1156821
Alignment:
| Q |
8 |
ctaaaactccgccaagtggaaaggttagaaaatttataattaagtttgcaaaatcattcccccctagagcatacaatatattgtcatctgattttcgtac |
107 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||| |
|
|
| T |
1156568 |
ctaaaactccaccaagtggaaaggttagaaaatttataattaagtttgcaaaatcattcccccctagggcatacaatatattgtcatccgattttcttac |
1156667 |
T |
|
| Q |
108 |
cacaaacttcacggtgatttgaacatcactacaaaaaatgttttcaacatcacaagaggaaatcattgattgcatcattgatcgctcaatagatggtttc |
207 |
Q |
| |
|
|| ||||| | |||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1156668 |
gaccaacttgatggtgatttgaacatcactacaaaatatgttttcaacatcacaagaggaaattattgattgcatcattaatcgctcaatagatggtttc |
1156767 |
T |
|
| Q |
208 |
tttcccaaaatcaaatcggttagaggtgtctttgaaagcaaggaacacttaagc |
261 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1156768 |
tttcccaaaaacaaatcggttagaggtgtcttggaaagcaaggaacacttaagc |
1156821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University