View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3787_low_11 (Length: 303)
Name: NF3787_low_11
Description: NF3787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3787_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 298
Target Start/End: Complemental strand, 37358697 - 37358414
Alignment:
| Q |
18 |
aaaatagcttatgatgatcataagttgtat-cataagnnnnnnnaaacattggattttataannnnnnn-atgttagaagataaattcaaataaatcaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37358697 |
aaaatagcttatgatgatcataagttgtattcataagtttttttaaacattggattttataaaaaaaattatgttagaagataaattcaaataaatcaat |
37358598 |
T |
|
| Q |
116 |
ctaaacaaaaccatattgtctagttgattttgtcaaaatcgtctctcattttgtcttttgaaacaaaattgtattctagataaacttcaatg-taagtaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37358597 |
ctaaacaaaaccatattgtctagttgattttgtcaaaatcgtctctcattttgtcttttgaaacaaaattgtattctagataaacttcaatgttaagtaa |
37358498 |
T |
|
| Q |
215 |
cacaatcgtgttcattatcccaatctgcttctccgtttggttgcattcacggggtcttaatcgctctcactttattcttctcac |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37358497 |
cacaatcgtgttcattatcccaatctgcttctccatttggttgcattcacggggtcttaatcgctctcactttattcttgtcac |
37358414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University